rs16864736 chr2:176931955 G>T
- Sequence
ttttttttttcattacttagcttt[G/T]tcatcatgctttcctaccaccaga
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) GM19238 (female B-cells lymphoblastoid cell lines) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN HTF4_HUMAN ATF7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.38 | -0.74 | 1.23 | n/a | No Hit | |||
| STAG1_HUMAN | 1.51 | 0.36 | 1.00 | n/a | n/a | |||
| HTF4_HUMAN | -1.82 | 2.22 | 1.00 | n/a | No Hit | |||
| ATF7_HUMAN | 0.66 | -0.66 | 1.00 | -1.34 | Weak Concordant | |||
| CREB1_HUMAN | 2.15 | -1.95 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP barnes akathisia rating scale, biploar disorder (bipolar schizoaffective disorder), height, hip bone mineral density (bmd), simpson-angus scale, spine bone mineral density (bmd)