rs16864907 chr3:189961461 G>A
- Sequence
tttaaagtaattcataataagcat[G/A]agaatcggccagctctaatgactt
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.92 | -1.35 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.62 | -1.26 | 1.00 |
Items per page:
1 – 2 of 2