rs16865333 chr1:157074266 A>C
- Sequence
cctggaggccgccattgcagatgc[A/C]cagcagcgcggagagctgactatt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.07 | -0.29 | 1.36 | n/a | No Hit | |||
| STAG1_HUMAN | 2.48 | -0.29 | 1.46 | n/a | n/a |
Items per page:
1 – 2 of 2