rs16871204 chr6:11277292 T>C
- Sequence
gagactatggttttggagagcaaa[T/C]gtaaacacagccaagaatggctac
- ASB in cell types
- breast tumor
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.68 | -5.64 | 4.00 | -2.83 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, barnes akathisia rating scale, fasting insulin, homa-b, homa-ir, ldl cholesterol, total cholesterol, triglycerides change with statins