rs16872575 chr7:20575272 C>T
- Sequence
tccatttcaccattgaaacattac[C/T]aggtcatcaacgattctgcctttg
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.89 | -0.63 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), cystatin c in serum, total cholesterol