rs16876093 chr8:29875137 T>G
- Sequence
atgtggaagagccctgaacagggc[T/G]aactaaaaggcctctcagtaagcg
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.41 | -1.11 | 1.00 | |||
| foreskin keratinocyte | 1.56 | n/a | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, ldl cholesterol change with statins, total cholesterol change with statins