rs16877005 chr4:25312372 A>G
- Sequence
caactatgatgtgcaactttcagc[A/G]ttgtccaaaagttacagaggatga
- ASB in cell types
- GM02630 (Fanconi anemi) GM12891 (male B- cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) RWPE1 (prostate epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.98 | -0.52 | 1.06 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, infant head circumference, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis