rs16878791 chr6:16690905 C>T
- Sequence
acctgtgcctcctgtccttagagc[C/T]ccagatttcattttaggagaggat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-134 (invasive lobular breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.47 | 0.86 | 1.28 | |||
| MDA-MB-134 (invasive lobular breast carcinoma) | 1.77 | -1.11 | 2.00 |
Items per page:
1 – 2 of 2