rs16880924 chr4:28686854 G>A
- Sequence
aggctatgctggcactcttggcag[G/A]cagagctttaatgagatcaccaga
- ASB in cell types
- WA09 (embryonic stem cells) MCF10CA1a (breast metastatic epithelial cells) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.59 | -0.84 | 1.43 | |||
| MCF10CA1a (breast metastatic epithelial cells) | n/a | 2.67 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.24 | 0.78 | 1.00 |
Items per page:
1 – 3 of 3