rs16887975 chr8:115988054 T>G
- Sequence
tatgcaattcggaaaaaaaaaaag[T/G]attgtacacaacttgaaaccaaat
- ASB in cell types
- breast tumor primary breast cancer
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.65 | -4.18 | 2.00 | |||
| primary breast cancer | 1.67 | -1.15 | 2.00 |
Items per page:
1 – 2 of 2