rs16895831 chr6:42548053 C>T
- Sequence
ttaggccactggcttggctgccgg[C/T]tgtggattccattgactggcggac
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM18526 (B – cells Lymphoblastoid Cell Lines) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 2.41 | -1.34 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -1.45 | 2.00 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.40 | 0.91 | 2.98 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
EMBL-EBI eosinophil percentage of granulocytes, eosinophil percentage of white cells, granulocyte percentage of myeloid white cells, monocyte percentage of white cells, neutrophil count, neutrophil percentage of granulocytes, neutrophil percentage of white cells, sum basophil neutrophil counts, sum neutrophil eosinophil counts
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid