rs16898244 chr8:100326029 G>T
- Sequence
aaagctatatgctatctgctatcc[G/T]ggtgttttatgctctttgtctaaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.84 | 0.01 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), diastolic blood pressure (dbp), fasting blood glucose, ldl cholesterol change with statins, paternal transmission distortion, rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol change with statins
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Lung, Pituitary