rs169082 chr5:169647052 C>T
- Sequence
cagcagagagcaccattattagta[C/T]taatgtccccattggacaggttgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.91 | 0.49 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, leptin, neuroblastoma (brain cancer), paternal transmission distortion, salmonella-induced pyroptosis, transmission distortion
PheWAS abnormal tumor markers, elevated cea or ca 125, alcoholic liver damage, aneurysm of other specified artery, anticoagulants causing adverse effects, aseptic necrosis of bone, atrophic gastritis, benign neoplasm of lip, oral cavity, and pharynx, breast conditions, congenital or relating to hormones, cardiac complications, not elsewhere classified, cervical radiculitis, chorioretinal scars, congenital anomalies of limbs, congenital deformities of feet, congenital pigmentary anomalies of skin, cornea replaced by transplant, corneal dystrophy, diplopia and disorders of binocular vision, diseases of the jaws, endometrial hyperplasia, extrinsic allergic alveolitis, flat foot, gastrointestinal complications, heartburn, infection/inflammation of internal prosthetic device, implant or graft, infections involving bone, inflammatory disease of cervix, vagina, and vulva, intracranial hemorrhage, jaw disease nos, kidney replaced by transpant, kyphosis (acquired), lipoid metabolism disorder nos, liver replaced by transplant, male genital disorders, morbid obesity, multiple myeloma, neoplasm of unspecified nature of digestive system, occlusion of cerebral arteries, with cerebral infarction, open wound of nose and sinus, orthostatic hypotension, osteomyelitis, other cerebral degenerations, other disorders of tympanic membrane, other disorders of urethra and urinary tract, other specified osteoporosis, paraproteinemia, perforation of tympanic membrane, periostitis, poisoning by agents primarily affecting blood constituents, postmenopausal atrophic vaginitis, postoperative infection, posttraumatic wound infection, pulmonary congestion and hypostasis, pyogenic arthritis, renal colic, retinal detachments and defects, secondary malignancy of lymph nodes, swelling of limb, symptoms involving head and neck, temporomandibular joint disorders, tinnitus, toxic erythema, unspecified erythematous condition, unspecified osteomyelitis, urethral stricture (not specified as infectious), ventral hernia