rs16911012 chr11:12290352 G>A
- Sequence
acctgaggtgtttctgtcaggctt[G/A]tttcctgaggtggccctggcttcc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- FLI1_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | -1.02 | 2.27 | 1.00 | 0.98 | Weak Concordant | |||
| ETS1_HUMAN | -1.22 | 1.67 | 1.00 | 1.43 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, parkinsons disease, total cholesterol, triglycerides change with statins