rs16914060 chr12:18250544 C>T
- Sequence
tagttaaaaacgcaggtttgcttt[C/T]cctcagaaacaaagcagatattcc
- ASB in cell types
- hepatocytes glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | -0.56 | 1.52 | 1.00 | |||
| glioblastoma cells | -2.17 | 0.97 | 1.33 |
Items per page:
1 – 2 of 2