rs16918334 chr11:28833990 T>A
- Sequence
cagggagcagacaagggtcagata[T/A]gaaatgttacattaatgtgtttga
- ASB in cell types
- A549 (lung carcinoma) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.18 | 0.99 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 1.59 | -1.15 | 1.00 |
Items per page:
1 – 2 of 2