rs16924795 chr10:24465622 C>A
- Sequence
cccagtccccaagggctcagaaaa[C/A]atgatggtaatcagagcctgcctg
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 1.51 | -2.80 | 1.50 | -2.20 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
