rs16929194 chr11:36623031 T>C
- Sequence
gtatttacatgctttgaccaaaga[T/C]gaagtatcagattcttctttttaa
- ASB in cell types
- GM02630 (Fanconi anemi) EOL-1 (Acute myeloid leukemia) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -1.11 | 1.20 | 1.00 | |||
| EOL-1 (Acute myeloid leukemia) | 2.00 | -1.67 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.54 | 0.71 | 1.00 |
Items per page:
1 – 3 of 3