rs16930401 chr12:402291 G>C
- Sequence
ctgtagggagcgcacgctagcatg[G/C]gagaaacgatagcaataaagcact
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | n/a | 3.42 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.22 | 0.78 | 2.07 |
Items per page:
1 – 2 of 2