rs16930650 chr9:9943040 T>C
- Sequence
cctgcactaactcggggcaaaagc[T/C]gatagtggatatagctggatgtca
- ASB in cell types
- neutrophils from periferal blood SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.63 | n/a | 1.50 | |||
| SK-N-SH (neuroblastoma) | 0.97 | 0.07 | 1.21 |
Items per page:
1 – 2 of 2