rs16935880 chr10:35126540 C>G
- Sequence
cgagaccacgccactgcagcccag[C/G]ctggacagaggtgagacgctcgcg
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) CTV-1 (Adult T acute lymphoblastic leukemia) MOLT-4 (Adult T acute lymphoblastic leukemia) GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 1.69 | -0.67 | 3.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.26 | 0.96 | 1.00 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | -0.18 | 1.05 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | -2.22 | 2.19 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Muscle_Skeletal, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood