rs16936119 chr8:69570323 C>T
- Sequence
tttactgttgaatttctggttctg[C/T]gagtttttctggacatgacaaaca
- ASB in cell types
- MCF7 WS8 cells MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 1.75 | 0.24 | 1.90 | -3.85 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
