rs16943118 chr15:89430894 C>T
- Sequence
acagcgacacctcgtggtagattt[C/T]ggaagtgcagcagagacggggcaa
- ASB in cell types
- epidermal keratinocytes PC9 (lung adenocarcinoma) KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.26 | 0.92 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 1.38 | n/a | 6.00 | |||
| KMS-11 (Plasma cell myeloma) | 0.35 | 1.08 | 2.00 |
Items per page:
1 – 3 of 3