rs16945589 chr12:115473600 A>G
- Sequence
ccaaattccaccaacagcccccaa[A/G]tgggtaaatcgccaagtgcaaagg
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.98 | -5.49 | 2.00 | n/a | No Hit | |||
| ESR1_HUMAN | 2.32 | -4.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), eye color, ldl cholesterol, ldl cholesterol change with statins, neuroblastoma (brain cancer), total cholesterol change with statins