rs16945692 chr17:61862883 A>G
- Sequence
ctaacattttgcgattctatctgt[A/G]aagctctgagaatgaggtatggtg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- GATA3_HUMAN RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 2.98 | -5.32 | 2.00 | n/a | No Hit | |||
| RFX1_HUMAN | 2.50 | -0.18 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, obesity with early age of onset (age >2), total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid