rs16949426 chr17:14387223 A>G
- Sequence
gcaaagcaaacagtacacttcaat[A/G]gcaatagcaatgaggatagtttac
- ASB in cell types
- VCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN MBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.08 | 1.35 | 2.00 | n/a | No Hit | |||
| MBL2_HUMAN | -0.94 | 2.02 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), college completion, hdl cholesterol, hdl cholesterol change with statins, infant head circumference, ldl cholesterol, years of education