rs16953671 chr15:46312278 T>C
- Sequence
tcaagggtctgtgattccattggt[T/C]tggctcttcaagcgctgatgtgag
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) testis Jurkat (T-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 1.17 | -0.03 | 1.50 | |||
| testis | -1.66 | 2.04 | 1.00 | |||
| Jurkat (T-cells) | 1.90 | 0.95 | 1.00 |
Items per page:
1 – 3 of 3