rs16953796 chr13:97018374 T>C
- Sequence
gcacaaaatgggaaagcaatctgt[T/C]tccttacttctacaaagcacagta
- ASB in cell types
- foreskin keratinocyte HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.98 | -2.98 | 2.00 | |||
| HeLa (cervical adenocarcinoma) | -5.36 | 1.69 | 3.00 |
Items per page:
1 – 2 of 2