rs16953973 chr15:78108298 C>T
- Sequence
tttgggatccagtgtctgatcaaa[C/T]gtgctgaggacaggagctttgacc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.84 | 0.54 | 1.04 | |||
| A549 (lung carcinoma) | 0.73 | 0.78 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, eye color, hdl cholesterol change with statins, partial epilepsy, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood