rs16955541 chr18:9753995 C>G
- Sequence
ttttccaagcccgagaaaaactat[C/G]cggtgccaagtgcatcaccactgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) hTERT-HME1(Telomerase immortalized cell line)
- ASB for transcription factors
- BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRCA2_HUMAN | 1.73 | -1.48 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, fasting insulin, total cholesterol change with statins, waist hip ratio