rs16967814 chr18:22490628 C>T
- Sequence
tacctatcactcttgttcaaggtc[C/T]gtttcctactgagttgtcacactg
- ASB in cell types
- HepG2 (hepatoblastoma) liver
- ASB for transcription factors
- HNF4A_HUMAN TEAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 1.87 | -3.27 | 1.50 | -2.31 | Concordant | |||
| TEAD3_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP amyotrophic lateral sclerosis (als), irritible bowel syndrome, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), neuroticism, panic disorder, type 1 diabetes, combined control dataset, urinary albumin-to-creatinine ratio