rs16972313 chr17:31597046 C>T
- Sequence
agaatggtcaaggctgggacaggc[C/T]ggaacaatgagctcatgtggcttc
- ASB in cell types
- monocytes from periferal blood HAEC (human aortic endothelial cells)
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 2.98 | 0.22 | 2.80 | n/a | No Hit |
Items per page:
1 – 1 of 1