rs16973746 chr16:24526465 C>T
- Sequence
acgccggacacttttatgaggctc[C/T]acctttccagagcattcctagcct
- ASB in cell types
- MCF10A (breast epithelial cells) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | 3.10 | -2.80 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, chronic kidney disease, infant head circumference, parkinsons disease, prop taste detection threshold