rs16974510 chr15:84735173 T>C
- Sequence
ttgcatcttcctagatcccctctt[T/C]gagacagtgtgttacaacttttcc
- ASB in cell types
- HEK293 (embryonic kidney) CD14+ monocytes MDM(monocyte derived macrophages)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.25 | -1.15 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hypertension (early onset hypertension), infant head circumference, ldl cholesterol change with statins, rheumatoid arthritis, tardive dyskinesia, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid