rs16974556 chr18:41378877 T>C
- Sequence
tctcttgttttttcacagcttaca[T/C]tgaaactttggcttcaatgcacac
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 2.29 | -1.53 | 1.00 | |||
| neural cell | -0.41 | 0.70 | 1.00 |
Items per page:
1 – 2 of 2