rs16975933 chr15:95987651 G>A
- Sequence
tctaaaaaactaagtgacacctcc[G/A]ttgcccaaaagcgtaaataacagc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.71 | -2.78 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, coronary artery disease (cad), fasting blood glucose, hdl cholesterol, homa-ir, infant head circumference, refractive error