rs16981003 chr22:25899066 C>T
- Sequence
tttaggacttggactctcagatca[C/T]gtgagccattctggcagagactgg
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.39 | 0.05 | 1.06 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, chronic kidney disease, fasting blood glucose, ldl cholesterol change with statins, total cholesterol change with statins, triglycerides change with statins