rs16982815 chrX:23797290 C>G
- Sequence
atgtcggggtactgtttgttagaa[C/G]tgcgaaggaggggcctgtctatcc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- IKZF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF3_HUMAN | -1.89 | 2.84 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Liver, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood