rs16987379 chr2:20107148 A>G
- Sequence
aacatcaggaaggaagagaaacag[A/G]tcaatgtaaaaataatgaactatg
- ASB in cell types
- GM02630 (Fanconi anemi) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 0.11 | 1.98 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1