rs16991104 chr22:43884853 A>G
- Sequence
agggaccagcatctgggctgggac[A/G]gagccggagcccaaatcccagcct
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines) glioblastoma patient-derived cell model
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.20 | -0.06 | 1.39 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis