rs16997918 chr22:37199876 C>T
- Sequence
gcatcgtgcgtttgttccgttctc[C/T]ctctggcagctgccgtttgataag
- ASB in cell types
- HEK293 (embryonic kidney) 22RV1 (prostate carcinoma) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.84 | 0.13 | 1.99 | |||
| 22RV1 (prostate carcinoma) | 2.54 | n/a | 2.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.03 | 1.55 | 1.00 |
Items per page:
1 – 3 of 3