rs17001654 chr4:76208415 C>G
- Sequence
acgacactgcctccgtttacagtg[C/G]tatagtttcttcctgtgctgagcc
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.74 | 0.34 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI bmi (adjusted for smoking behaviour), body mass index, body mass index (joint analysis main effects and smoking interaction)
GRASP body mass index (bmi), cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, lp-pla2 mass, obesity with early age of onset (age >2), parkinsons disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood