rs17002253 chr4:76850192 T>C
- Sequence
gtttgtttaacaaggccccagatg[T/C]gtcttatcatcagggaagtttggt
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.44 | 1.45 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), imprinting effects on cleft lip without cleft palate, phenytoin-induced hypersensitivity, total lamotrigine and phenytoin-induced hypersensitivity
PheWAS adverse drug events and drug allergies, allergic reaction to food, alopecia areata, angina pectoris, anomalies of jaw size/symmetry, aphakia and other disorders of lens, aphasia/speech disturbance, benign neoplasm of brain and other parts of nervous system, brain cancer, cancer of brain and nervous system, cardiac pacemaker in situ, cellulitis and abscess of hand/fingers, chorioretinal scars, cirrhosis of liver without mention of alcohol, congenital pigmentary anomalies of skin, corneal degenerations, corneal opacity, diplopia and disorders of binocular vision, disorders of choroid, disorders of cornea, dyspareunia, epilepsy, esophageal bleeding, eye infection, viral, fluid overload, heart valve replaced, hypercalcemia, hypotension nos, liver abscess and sequelae of chronic liver disease, macular degeneration, dry, macular puckering of retina, malunion fracture, migrain with aura, migraine, morbid obesity, other disorders of bone and cartilage, ovarian dysfunction, pathologic fracture, polycystic ovaries, portal hypertension, pulmonary embolism and infarction, pulmonary heart disease, retinal detachment with retinal defect, sciatica, sialoadenitis, spinal stenosis, stiffness of joint, uterine cancer, vertiginous syndromes and other disorders of vestibular system