rs17003427 chr4:78721263 C>T
- Sequence
tctcttccatttccggttttgagt[C/T]ctgggctcttttatcttgctcctc
- ASB in cell types
- MM1.S (plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -3.93 | 2.54 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, college completion, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, diastolic blood pressure (dbp), late onset alzheimers disease, triglycerides
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood