rs17010429 chr2:30883108 C>A
- Sequence
gagctgaaagaccaggggcataag[C/A]cttttgtgtgtcacagccatggtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -1.96 | 1.92 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, acute lung injury following major trauma, advanced age-related macular degeneration (geographic atrophy), birth weight, chronic kidney disease, ldl cholesterol, systolic blood pressure (sbp), total cholesterol