rs17013095 chr2:33478322 G>A
- Sequence
tctgttcctcggtatggcatttgt[G/A]tgaggtccttgggtcagcccgcgg
- ASB in cell types
- CD14+ monocytes MDM(monocyte derived macrophages)
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.07 | -0.12 | 1.67 | n/a | No Hit | |||
| SPI1_HUMAN | 1.27 | 0.26 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, prop taste detection threshold, sporadic creutzfeldt-jakob disease, triglycerides