rs17015379 chr1:209850420 A>G
- Sequence
aaacttaccttctgtgaaagaaat[A/G]aaatccccaagggagtctaacgtc
- ASB in cell types
- GM17942 (lymphoblastoid cell) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 1.97 | -1.71 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.54 | 0.16 | 1.97 |
Items per page:
1 – 2 of 2