rs17021364 chr4:94126742 T>C
- Sequence
tttggatgattaggtatatcatag[T/C]aggagcgaaagaatgtaagggaaa
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) H929 (plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.65 | 1.03 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, bipolar disorder and schizophrenia, body mass index (bmi), college completion, fasting blood glucose, fasting insulin, homa-ir, ldl cholesterol change with statins, obesity with early age of onset (age >2), schizophrenia, total cholesterol change with statins