rs17025114 chr3:30221726 A>C
- Sequence
gagaaatgatttgacaagtatgaa[A/C]gtgcaaggtgtccctgcatcataa
- ASB in cell types
- MM1.S (plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.81 | -1.54 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, ldl cholesterol change with statins, paternal transmission distortion, total cholesterol change with statins, transmission distortion