rs17029976 chr3:33331711 C>A
- Sequence
gattcctgagctttccacacctca[C/A]taatcggatgaaaatgagatcatg
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- NDF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NDF1_HUMAN | 1.74 | -0.43 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1